Gene

FeatureValue
SymbolTP53
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
Linkouts NCBI
Chromosome17
Genomic Start Position7571719
Genomic End Position7590862
Positive Strand?No
SynonymsFLJ92943, LFS1, P53, TRP53
Number of hits in genomic region283
Hits in genomic region
FeatureValue
microRNAhsa-miR-4644
Chromosome17
Genomic Start Position7567736
Genomic End Position7567760
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.240
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -295.98
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GA-AGACAGAGA-AAAGAGAGAGGu
;; ;;; ;;;;; ; ;;; ;;; ;
CTATCTATCTCTCTATCTATCTACt
GATAGATAGAGAGATAGATAGATGa
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4644
Chromosome17
Genomic Start Position7567759
Genomic End Position7567783
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.240
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -295.98
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GA-AGACAGAGA-AAAGAGAGAGGu
;; ;;; ;;;;; ; ;;; ;;; ;
CTATCTATCTCTCTATCTATCTACt
GATAGATAGAGAGATAGATAGATGa
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4769-5p
Chromosome17
Genomic Start Position7569003
Genomic End Position7569030
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.176
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -364.62
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gAGUAUGG-AAGA-GAGGUAG--GGUGG
$$ $ $$ $$$$ $$ $ $$ $$ $$
aAGTACGGTAAGAGGACGGAGTCGGAGG
tTCATGCCATTCTCCTGCCTCAGCCTCC
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4644
Chromosome17
Genomic Start Position7569112
Genomic End Position7569134
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.252
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -198.03
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gAAGACAGAGAAAAGAGAGAggu
$$$$ $ $$$$$$$$ $ $
aAAGAAAAAGAAAAGAAAAAaaa
tTTCTTTTTCTTTTCTTTTTttt
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4668-5p
Chromosome17
Genomic Start Position7569378
Genomic End Position7569400
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.248
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -178.49
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cuguuuAGGAAAAAAAAAAGgga
;;; ;;;;;;;;;;
ttttctTCCATTTTTTTTTCttt
aaaagaAGGTAAAAAAAAAGaaa
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4668-5p
Chromosome17
Genomic Start Position7570578
Genomic End Position7570600
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.260
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -161.33
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cuguuuAGGAAAAAAAAAAggga
$$$$$$$$$$$$$
actcgaAGGAAAAAAAAAAaaat
tgagctTCCTTTTTTTTTTttta
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4644
Chromosome17
Genomic Start Position7570748
Genomic End Position7570770
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.292
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -251.89
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gAAGACAGAGAAAAGAGAGAGGu
$$$$ $$$$$$$$ $ $ $$$
tAAGAAAGAGAAAAAAAAAAGGt
aTTCTTTCTCTTTTTTTTTTCCa
Match Typedirect
Grade2
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4668-5p
Chromosome17
Genomic Start Position7570748
Genomic End Position7570771
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.264
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -215.19
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cuguuuAG-GAAAAAAAAAAGGga
$$ $$$$$$$$$$$$$
taagaaAGAGAAAAAAAAAAGGtg
attcttTCTCTTTTTTTTTTCCac
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4668-5p
Chromosome17
Genomic Start Position7570754
Genomic End Position7570776
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.288
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -215.19
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cuguuuaGGAAAAAAAAAAGGGA
$$$$$$$$$$$$$ $$
ttctggtGGAAAAAAAAAAGAGA
aagaccaCCTTTTTTTTTTCTCT
Match Typedirect
Grade2
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-638
Chromosome17
Genomic Start Position7570918
Genomic End Position7570944
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.156
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -386.79
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
uccGGCGGUGG-G-CGGGCGCUAGGGa
;; ;; ;; ; ;;; ; ;;;;
ggaCCACCACCTCTACCCACAATCCCa
cctGGTGGTGGAGATGGGTGTTAGGGt
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3154
Chromosome17
Genomic Start Position7570997
Genomic End Position7571020
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.220
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -337.69
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
AGACGAG-GGUUGA-GGGGAAGAc
$$$ $$ $$ $$ $$$$$$$$
AGAGCAGTGGGTGATGGGGAAGAg
TCTCGTCACCCACTACCCCTTCTc
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-197-5p
Chromosome17
Genomic Start Position7571020
Genomic End Position7571044
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.176
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -379.4
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGA-GGGUGACGGGAG-AGAUGGGc
;;; ;;; ; ;;;;; ;; ;;
CCTCCCCCCGACCCTCGTCCGTCCg
GGAGGGGGGCTGGGAGCAGGCAGGc
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4728-5p
Chromosome17
Genomic Start Position7571023
Genomic End Position7571046
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.212
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -362.24
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ACGAACGACGG-AGAGGGGAGGGu
; ; ; ;; ;; ; ;;;;;;;;
TGCCTGCTCCCAGCCCCCCTCCCt
ACGGACGAGGGTCGGGGGGAGGGa
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3162-5p
Chromosome17
Genomic Start Position7571089
Genomic End Position7571114
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.204
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -372.01
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GAGG-GGUGGG--AAGAUGAGGGAuu
;;;; ; ;;; ;;; ;;;;;;
CTCCTCAACCCGACTCTCCTCCCTat
GAGGAGTTGGGCTGAGAGGAGGGAta
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-5196-5p
Chromosome17
Genomic Start Position7571097
Genomic End Position7571118
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.228
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -352.47
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGGUUGGGAGCAGGGGAAGGGa
;;; ; ;;; ;;;; ;;;;
CCCGACTCTCCTCCCTATCCCa
GGGCTGAGAGGAGGGATAGGGt
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-197-5p
Chromosome17
Genomic Start Position7571278
Genomic End Position7571300
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.272
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -345.08
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGAGGGUGACGGGAGAGAUGggc
;;;;;; ;; ;;;;;;; ;
CCTCCCACTGGCCTCTCTCCatc
GGAGGGTGACCGGAGAGAGGtag
Match Typeindirect
Grade2
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4739
Chromosome17
Genomic Start Position7571488
Genomic End Position7571512
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.252
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -352.47
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ucccgGGGAGGCGAGGAGGAGGGAa
$$ $$ $ $$$$$$$$$$
gccgtGGCCGGAGGGGAGGAGGGAc
cggcaCCGGCCTCCCCTCCTCCCTg
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4739
Chromosome17
Genomic Start Position7571491
Genomic End Position7571515
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.232
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -342.7
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ucccgGGGAGGCGAGGAGGAGGGaa
$$$$$$ $ $$$$$ $$
tggcaGGGAGGAGGGGAGGCCGGtg
accgtCCCTCCTCCCCTCCGGCCac
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-5196-5p
Chromosome17
Genomic Start Position7571494
Genomic End Position7571515
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.232
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -325.54
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gGGUUGGGAGCAGGGGAAGgga
$$ $$$$$ $$$$$$ $
tGGCAGGGAGGAGGGGAGGccg
aCCGTCCCTCCTCCCCTCCggc
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1207-5p
Chromosome17
Genomic Start Position7571495
Genomic End Position7571515
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.264
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -352.47
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ggGGAGGGUCGGAGGGACGGu
$$$$$$ $$$$$$$ $$
ccGGAGGGGAGGAGGGACGGt
ggCCTCCCCTCCTCCCTGCCa
Match Typedirect
Grade2
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4739
Chromosome17
Genomic Start Position7571660
Genomic End Position7571688
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.220
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -416.1
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ucccGGGGAG-GCGAGGAGG---AGGGAA
;;;; ; ; ;;;;;;; ;;;;;
acgtCCCCACTCACTCCTCCACGACCCTT
tgcaGGGGTGAGTGAGGAGGTGCTGGGAA
Match Typeindirect
Grade2
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-5196-5p
Chromosome17
Genomic Start Position7571662
Genomic End Position7571685
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.176
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -379.4
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGGUUG-GGAGCAG-GGGAAGGGA
;;; ; ;;;; ;; ; ; ;;;;
CCCAGCACCTCCTCACTCACCCCT
GGGTCGTGGAGGAGTGAGTGGGGA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3960
Chromosome17
Genomic Start Position7571663
Genomic End Position7571683
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.172
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -359.86
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGGGGCG-GAGGCGGCGGCGG
;;; ; ; ;;;; ;; ; ;;
CCCACTCACTCCTCCACGACC
GGGTGAGTGAGGAGGTGCTGG
Match Typeindirect
Grade4
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-483-5p
Chromosome17
Genomic Start Position7571778
Genomic End Position7571799
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.248
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -276.44
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GAGGGAAGAAAGGAGGGCAGAA
$$$$$$$ $$ $$$$ $ $$
GAGGGAAAAATATAGGGTAAAA
CTCCCTTTTTATATCCCATTTT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4706
Chromosome17
Genomic Start Position7571787
Genomic End Position7571811
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.248
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -298.61
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
uucgucgcGGGUGAAGGAGGGGcga
$$$ $$$$$$$$$$
tataaaaaGGGAGAAGGAGGGGaag
atatttttCCCTCTTCCTCCCCttc
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3138
Chromosome17
Genomic Start Position7571792
Genomic End Position7571815
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.252
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -318.15
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ugAGGGAGAUGGAGUGACAGGugu
$$$$$$$ $$$$ $ $$$
aaAGGGAGAAGGAGGGGAAGGgtg
ttTCCCTCTTCCTCCCCTTCCcac
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4739
Chromosome17
Genomic Start Position7571793
Genomic End Position7571817
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.324
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -381.78
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ucccGGGGAGGCGAGGAGGAGGGAA
$$$ $$$ $$$$$ $$$$$$$
gggtGGGAAGGGGAGGAAGAGGGAA
cccaCCCTTCCCCTCCTTCTCCCTT
Match Typedirect
Grade1
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4646-5p
Chromosome17
Genomic Start Position7571794
Genomic End Position7571816
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.248
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -345.08
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
AGGGAG-UCGAGGAGAAGGGuca
$$$$$$ $$$$ $$$$$$
AGGGAGAAGGAGGGGAAGGGtgg
TCCCTCTTCCTCCCCTTCCCacc
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4763-3p
Chromosome17
Genomic Start Position7571794
Genomic End Position7571817
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.192
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -369.63
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGGCGGGUCGUGGUCGGGGACGGA
$$$ $$$ $ $$ $ $$ $$$
GGGTGGGAAGGGGAGGAAGAGGGA
CCCACCCTTCCCCTCCTTCTCCCT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1207-5p
Chromosome17
Genomic Start Position7571797
Genomic End Position7571818
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.184
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -359.86
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGGGAGGGUCGGAG-GGACGgu
$$$$ $$$ $$ $ $$$ $
GGGGTGGGAAGGGGAGGAAGag
CCCCACCCTTCCCCTCCTTCtc
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3162-5p
Chromosome17
Genomic Start Position7571798
Genomic End Position7571820
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.260
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -362.24
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GAGGGGUGGGAAGAUGAGGGAuu
$ $$$$ $$$$$$ $$$$ $
GTGGGGTGGGAAGGGGAGGAAga
CACCCCACCCTTCCCCTCCTTct
Match Typedirect
Grade2
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4739
Chromosome17
Genomic Start Position7572718
Genomic End Position7572743
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.252
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -335.31
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ucccgggGAGGCG-AGGAGGAGGGaa
;;;; ; ;;;;;;;;;;
tgtcctaCTCCCCATCCTCCTCCCca
acaggatGAGGGGTAGGAGGAGGGgt
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4459
Chromosome17
Genomic Start Position7572721
Genomic End Position7572742
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.240
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -335.31
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GAGGUGGAGGAGGCGGAGGAcc
; ;; ;;;;;; ; ;;;; ;
CCCCTCCTCCTACCCCTCATcc
GGGGAGGAGGATGGGGAGTAgg
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4459
Chromosome17
Genomic Start Position7572725
Genomic End Position7572746
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.232
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -325.54
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GAGGUGGAGGAGGCGGAGgacc
;;;; ; ;;;;;; ;; ;
CTCCCCATCCTCCTCCCCacaa
GAGGGGTAGGAGGAGGGGtgtt
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4739
Chromosome17
Genomic Start Position7572726
Genomic End Position7572751
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.228
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -335.31
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ucccgggGAGGCGAGGAGGA-GGGAA
; ;; ;;;;;;;; ;;; ;
aaaacaaCACCCCTCCTCCTACCCCT
ttttgttGTGGGGAGGAGGATGGGGA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1183
Chromosome17
Genomic Start Position7572864
Genomic End Position7572890
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.228
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -335.31
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
acGGGUGAGAGUGGUAGUGGAUGucac
$$$ $$$$ $$ $$ $$$ $
tgGGGGTAGAGAGGGAGGGGACGgtaa
acCCCCATCTCTCCCTCCCCTGCcatt
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-5196-5p
Chromosome17
Genomic Start Position7572865
Genomic End Position7572887
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.212
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -362.24
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGGUUGGGA-GCAGGGGAAGGGA
$$$ $ $$ $ $$$$$$ $$ $
GGGTAGAGAGGGAGGGGACGGTA
CCCATCTCTCCCTCCCCTGCCAT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4763-3p
Chromosome17
Genomic Start Position7572866
Genomic End Position7572889
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.172
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -359.86
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGGCGGGUCGUGGUCGGGGACGGa
$$$ $ $ $$ $$$$$ $$
GGGGGTAGAGAGGGAGGGGACGGt
CCCCCATCTCTCCCTCCCCTGCCa
Match Typedirect
Grade4
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3147
Chromosome17
Genomic Start Position7572867
Genomic End Position7572892
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.196
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -406.33
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aGUGUGGG-AG-GAGUGACGGGUUGG
$ $ $$$ $$ $$$ $$ $$$ $$
gGTGGGGGTAGAGAGGGAGGGGACGG
cCACCCCCATCTCTCCCTCCCCTGCC
Match Typedirect
Grade2
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4739
Chromosome17
Genomic Start Position7572867
Genomic End Position7572895
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.200
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -406.33
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ucccGGGGAG---GCGA-GGAGGAGGGAa
$$$$$$ $ $$ $$ $$ $$$$
ggcaGGGGAGGGAGAGATGGGGGTGGGAg
ccgtCCCCTCCCTCTCTACCCCCACCCTc
Match Typedirect
Grade2
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3162-5p
Chromosome17
Genomic Start Position7572869
Genomic End Position7572892
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.248
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -362.24
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gAGGGGUGGGA-AGAUGAGGGauu
$$$$$ $$$$ $$$ $ $$$
cAGGGGAGGGAGAGATGGGGGtgg
gTCCCCTCCCTCTCTACCCCCacc
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3162-5p
Chromosome17
Genomic Start Position7572869
Genomic End Position7572895
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.200
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -389.17
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GAGGG-GUGGGAAGA---UGAGGGauu
$$$$$ $ $$$ $$$ $$$$$
GAGGGTGGGGGTAGAGAGGGAGGGgac
CTCCCACCCCCATCTCTCCCTCCCctg
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4271
Chromosome17
Genomic Start Position7572871
Genomic End Position7572889
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.252
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -352.47
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGGGUGGAAAAGAAGGGGG
$$$$ $$ $ $$$ $$$$$
GGGGAGGGAGAGATGGGGG
CCCCTCCCTCTCTACCCCC
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1207-5p
Chromosome17
Genomic Start Position7572871
Genomic End Position7572892
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.204
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -369.63
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGGGAGGGUCG-GAGGGACGGu
$$ $ $$$ $ $$$$$$ $$
GGTGGGGGTAGAGAGGGAGGGg
CCACCCCCATCTCTCCCTCCCc
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-5196-5p
Chromosome17
Genomic Start Position7572872
Genomic End Position7572894
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.212
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -396.56
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGGUUGG-GAGCAGGGGAAGGGA
$$$ $$ $$$ $$$$ $$$$
GGGAGGGAGAGATGGGGGTGGGA
CCCTCCCTCTCTACCCCCACCCT
Match Typedirect
Grade2
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1228-5p
Chromosome17
Genomic Start Position7572874
Genomic End Position7572895
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.192
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -386.79
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GUGUGUG-GACGGGGGCGGGUG
$ $ $ $ $$ $$$$$ $$$ $
GAGGGAGAGATGGGGGTGGGAG
CTCCCTCTCTACCCCCACCCTC
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-197-5p
Chromosome17
Genomic Start Position7572874
Genomic End Position7572896
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.260
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -362.24
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGAGGGUGACGGGAGAGAUGGgc
$$$$$$ $ $$ $$$$$ $$
GGAGGGTGGGGGTAGAGAGGGag
CCTCCCACCCCCATCTCTCCCtc
Match Typedirect
Grade2
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3141
Chromosome17
Genomic Start Position7572876
Genomic End Position7572895
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.228
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -352.47
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aGGAG-GAGGUGGGCGGGAG
$$$$ $$ $ $$$ $$$$$
gGGAGAGATGGGGGTGGGAG
cCCTCTCTACCCCCACCCTC
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-5196-5p
Chromosome17
Genomic Start Position7573668
Genomic End Position7573691
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.188
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -379.4
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGGUUGGGAGCAG-GG-GAAGGGa
$$$ $$$$$ $ $$ $$$ $$
GGGCTGGGAGTTGCGGAGAATGGc
CCCGACCCTCAACGCCTCTTACCg
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-197-5p
Chromosome17
Genomic Start Position7573881
Genomic End Position7573906
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.172
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -362.24
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGA--GGG-UGACGGGAGAGAUGGgc
$$$ $$$ $$ $$$$ $$ $$
GGACCGGGATGAGGGGACGGAAGGat
CCTGGCCCTACTCCCCTGCCTTCCta
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4728-5p
Chromosome17
Genomic Start Position7573886
Genomic End Position7573911
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.216
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -354.85
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
acGAACGA--CGGA-GAGGGGAGGGu
$$$ $$ $$$ $$$$$$$ $$
ggGAAGGACCGGGATGAGGGGACGGa
ccCTTCCTGGCCCTACTCCCCTGCCt
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3138
Chromosome17
Genomic Start Position7573890
Genomic End Position7573918
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.140
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -372.01
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
uGAG--GGAGAUGGA--GUGA-CAGGUGu
$$$ $$ $$ $$$ $ $$ $$$ $
gGAGTCGGGGAAGGACCGGGATGAGGGGa
cCTCAGCCCCTTCCTGGCCCTACTCCCCt
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-197-5p
Chromosome17
Genomic Start Position7573936
Genomic End Position7573960
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.196
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -379.4
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGAGGGUG--ACGGGAGAGAUGGGc
;;; ;; ; ; ;;; ;;; ;;;
CCTTCCTCGGTCCCCCCTCGTCCCg
GGAAGGAGCCAGGGGGGAGCAGGGc
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4644
Chromosome17
Genomic Start Position7574613
Genomic End Position7574636
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.276
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -278.82
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GAAGACAGAGAAAAGAGA-GAGGu
;;; ; ; ;;;;;;;; ; ;;;;
CTTTTTTTTCTTTTCTTTGCTCCg
GAAAAAAAAGAAAAGAAACGAGGc
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-197-5p
Chromosome17
Genomic Start Position7574680
Genomic End Position7574705
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.192
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -362.24
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGAGGGUGACGGGAG---AGAUGGgc
;;;;; ; ;;;;; ;;; ;;
CCTCCAACGTCCCTCGGTTCTACCgc
GGAGGTTGCAGGGAGCCAAGATGGcg
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4459
Chromosome17
Genomic Start Position7574691
Genomic End Position7574714
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.220
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -362.24
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GAGG--UGGAGGAGGCGGAGGAcc
;;;; ; ;;;;; ;;;;;;
CTCCCTGCAACCTCCGCCTCCTgg
GAGGGACGTTGGAGGCGGAGGAcc
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4739
Chromosome17
Genomic Start Position7574857
Genomic End Position7574882
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.216
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -352.47
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ucccgGGGAGG-CGAGGAGGAGGGAa
;;;;;; ;;;; ;; ;;;
taaagCCCTCCGACTCCGCCCACCTa
atttcGGGAGGCTGAGGCGGGTGGAt
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4739
Chromosome17
Genomic Start Position7575169
Genomic End Position7575194
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.268
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -389.17
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ucccGGGGAGG-CGAGGAGGAGGGAa
$$$$$$$ $$$$ $$$ $$$
acttGGGGAGGCTGAGGTGGAAGGAt
tgaaCCCCTCCGACTCCACCTTCCTa
Match Typedirect
Grade2
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4459
Chromosome17
Genomic Start Position7575173
Genomic End Position7575195
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.204
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -352.47
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GAGGUGGAGGAGGCGG-AGGAcc
$ $$ $$ $$$$ $$ $$$$
GGGGAGGCTGAGGTGGAAGGAtt
CCCCTCCGACTCCACCTTCCTaa
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4739
Chromosome17
Genomic Start Position7575463
Genomic End Position7575488
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.216
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -352.47
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ucccgGGGAGG-CGAGGAGGAGGGAa
$$$$$$ $$$$ $$ $$$
actttGGGAGGCCGAGGCGGGCGGAt
tgaaaCCCTCCGGCTCCGCCCGCCTa
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4739
Chromosome17
Genomic Start Position7575787
Genomic End Position7575816
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.196
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -372.01
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ucccgGGGAGG-CGA----GGAGGAGGGAa
$$$$$$ $$ $$$$$$ $$$
aacttGGGAGGCTGAGCTGGGAGGATGGAt
ttgaaCCCTCCGACTCGACCCTCCTACCTa
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3162-5p
Chromosome17
Genomic Start Position7575802
Genomic End Position7575828
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.168
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -362.24
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GAGGG---GUGGGAAG-AUGAGGGauu
$$$$$ $ $$ $ $ $ $$$$$
GAGGGTCCGAGGTAGGTAGGAGGGtcg
CTCCCAGGCTCCATCCATCCTCCCagc
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4739
Chromosome17
Genomic Start Position7576010
Genomic End Position7576035
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.204
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -352.47
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ucccGGGGAGG-CGAGGAGGAGGGAa
$$$$$$$ $$$ $ $$$$
tactGGGGAGGCAGAGTTAGGGGGAt
atgaCCCCTCCGTCTCAATCCCCCTa
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4271
Chromosome17
Genomic Start Position7576014
Genomic End Position7576033
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.216
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -352.47
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGGGUGGAAAAG-AAGGGGG
$$$$ $$ $ $$ $$$$$$
GGGGAGGCAGAGTTAGGGGG
CCCCTCCGTCTCAATCCCCC
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4739
Chromosome17
Genomic Start Position7576026
Genomic End Position7576055
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.152
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -372.01
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ucccGGGGA--G-GCGAG--GAGGAGGGAA
$$$$$ $ $$$ $$$$$$$ $
ttagGGGGATTGCTTGAGCCCAGGAGGGTA
aatcCCCCTAACGAACTCGGGTCCTCCCAT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4739
Chromosome17
Genomic Start Position7576975
Genomic End Position7577000
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.224
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -345.08
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ucccGGGGAGGCGAGGAGGAGG-GAA
;;; ; ;;;;;;; ;; ;;;
tgcaCCCTTGGTCTCCTCCACCGCTT
acgtGGGAACCAGAGGAGGTGGCGAA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3162-5p
Chromosome17
Genomic Start Position7576987
Genomic End Position7577011
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.212
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -345.08
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GAGG-GGUGG-GAAGAUGAGGgauu
;;;; ;; ;; ;;;;; ;;;
CTCCTCCACCGCTTCTTGTCCtgct
GAGGAGGTGGCGAAGAACAGGacga
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-483-5p
Chromosome17
Genomic Start Position7576999
Genomic End Position7577021
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.244
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -303.37
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GAGGGAAGAAAGGAGG-GCAGAA
;;;; ;;; ;;; ;;; ;;;;
CTCCATTCGTTCGTCCTGTTCTT
GAGGTAAGCAAGCAGGACAAGAA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1207-5p
Chromosome17
Genomic Start Position7577371
Genomic End Position7577395
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.148
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -379.4
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGGGA-GGGUCG-GAG--GGACGGu
$$$$$ $ $ $ $$$ $$$ $$
GGGGATGTGATGAGAGGTGGATGGg
CCCCTACACTACTCTCCACCTACCc
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4769-5p
Chromosome17
Genomic Start Position7577399
Genomic End Position7577426
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.176
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -364.62
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gAGUAUGGAAGAGA--GG-UAG-GGUGG
$$ $ $$$$$$ $ $$ $$ $$ $$
tAGTATGGAAGAAATCGGTAAGAGGTGG
aTCATACCTTCTTTAGCCATTCTCCACC
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-197-5p
Chromosome17
Genomic Start Position7577649
Genomic End Position7577676
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.160
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -389.17
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGAGGG--UGACGGGAG---AGAUGGGc
$$$$$$ $$ $$ $ $$$ $$$
GGAGGGGACGAACGGTGTCCAGAGGGGt
CCTCCCCTGCTTGCCACAGGTCTCCCCa
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4739
Chromosome17
Genomic Start Position7578130
Genomic End Position7578154
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.232
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -325.54
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ucccgGGGAGGCGAGGAGGAGGGaa
;;;; ; ;;;;;;;;;
aaccaCCCTTAACCCCTCCTCCCag
ttggtGGGAATTGGGGAGGAGGGtc
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-5196-5p
Chromosome17
Genomic Start Position7578134
Genomic End Position7578157
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.236
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -335.31
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ggguuGGGAGCAGGGG--AAGGGa
;;;;; ;;;;; ;;;;;
agagaCCCTCCTCCCCAATTCCCa
tctctGGGAGGAGGGGTTAAGGGt
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-5196-5p
Chromosome17
Genomic Start Position7579388
Genomic End Position7579412
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.192
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -362.24
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGGUUGGGAGCAG---GGGAAGGGa
$$$ $ $$ $$ $$$$$$$$
GGGACAGTAGAAGACAGGGAAGGGt
CCCTGTCATCTTCTGTCCCTTCCCa
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-197-5p
Chromosome17
Genomic Start Position7579576
Genomic End Position7579602
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.156
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -372.01
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGAGGGUGA-CGGGA--G-AGAUGGGc
$$$ $$ $ $$$$ $ $$$ $$$
GGACGGCAAGGGGGACTGTAGATGGGt
CCTGCCGTTCCCCCTGACATCTACCCa
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-5196-5p
Chromosome17
Genomic Start Position7579645
Genomic End Position7579669
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.212
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -406.33
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGGUUGGGAG---CAGGGGAAGGGA
;;; ;;;;; ;;;;; ;;;;
CCCAGCCCTCCAGGTCCCCAGCCCT
GGGTCGGGAGGTCCAGGGGTCGGGA
Match Typeindirect
Grade2
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-762
Chromosome17
Genomic Start Position7579784
Genomic End Position7579805
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.196
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -377.02
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cGAGCCGGGGCCGGGGUCGGGG
$ $ $$$$ $$$$ $$$$
gGGGCTGGGGTTGGGGTGGGGG
cCCCGACCCCAACCCCACCCCC
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4763-3p
Chromosome17
Genomic Start Position7579785
Genomic End Position7579808
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.172
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -377.02
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGGCGGGUCGUGGUCGGGGACGGa
$$ $$$ $ $$ $$$$ $$
GGTGGGGGTGGGGTTGGGGTCGGg
CCACCCCCACCCCAACCCCAGCCc
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-762
Chromosome17
Genomic Start Position7579790
Genomic End Position7579811
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.196
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -377.02
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cGAGCCGGGGCCGGGGUCGGGG
$ $ $$$$ $$$$ $$$$
gGTGGTGGGGGTGGGGTTGGGG
cCACCACCCCCACCCCAACCCC
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-5196-5p
Chromosome17
Genomic Start Position7580231
Genomic End Position7580253
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.204
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -352.47
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gGGUUGGGAGCAGGGGA-AGGGa
;; ;;;;; ;;; ; ;;;;
tCCTTCCCTCAACCCTTATCCCa
aGGAAGGGAGTTGGGAATAGGGt
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1226-5p
Chromosome17
Genomic Start Position7580615
Genomic End Position7580640
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.168
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -369.63
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGGGUAGGUCCGGACGUACGGGAGUG
;;;; ;;; ;; ; ;;; ; ;
CCCCTTCCCACCCCCGGTTCCCCCAC
GGGGAAGGGTGGGGGCCAAGGGGGTG
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4739
Chromosome17
Genomic Start Position7580617
Genomic End Position7580644
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.184
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -369.63
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ucccGGGGAGGCGAGGAGG---AGGGaa
;;;;; ; ; ;; ;; ;;;;
tccaCCCCTTCCCACCCCCGGTTCCCcc
aggtGGGGAAGGGTGGGGGCCAAGGGgg
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4644
Chromosome17
Genomic Start Position7581154
Genomic End Position7581177
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.256
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -286.21
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gAAGACAGAGA-AAAGAGAGAGGu
$$$$ $$ $$ $$$$$$ $$$
tAAGAGAGCGAGAAAGAGCAAGGg
aTTCTCTCGCTCTTTCTCGTTCCc
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4433-3p
Chromosome17
Genomic Start Position7583096
Genomic End Position7583116
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.236
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -315.77
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
uacAGGGUGGGGGUGAGGaca
;;;; ;;;;; ;;;;
tgcTCCCACCCCCACTCCatt
acgAGGGTGGGGGTGAGGtaa
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-483-5p
Chromosome17
Genomic Start Position7583234
Genomic End Position7583259
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.220
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -340.07
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GAGGGA-AGAA--AG-GAGGGCAGAA
;;;;;; ;;;; ;; ;;; ;;;;
CTCCCTGTCTTTATCTCTCAAATCTT
GAGGGACAGAAATAGAGAGTTTAGAA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4459
Chromosome17
Genomic Start Position7584343
Genomic End Position7584365
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.228
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -335.31
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaGGUGGA-GGAGGCGGAGGAcc
;; ;;; ;;;; ;;;;;;
agCCACCTGCCTCAGCCTCCTaa
tcGGTGGACGGAGTCGGAGGAtt
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4668-5p
Chromosome17
Genomic Start Position7584480
Genomic End Position7584502
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.260
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -161.33
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cuguuuAGGAAAAAAAAAAggga
;;;;;;;;;;;;;
tttcttTCCTTTTTTTTTTtttt
aaagaaAGGAAAAAAAAAAaaaa
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4739
Chromosome17
Genomic Start Position7584893
Genomic End Position7584918
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.216
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -352.47
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ucccgGGGAGG-CGAGGAGGAGGGAa
;;;;;; ;;;; ;; ;;;
tgaaaCCCTCCGGCTCCACCCACCTa
actttGGGAGGCCGAGGTGGGTGGAt
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-197-5p
Chromosome17
Genomic Start Position7585629
Genomic End Position7585651
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.248
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -345.08
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGAGGGUGACGGGAGAGAUGGGc
;;;;; ;; ; ;;;;;; ;;
CCTCCGACTCCGCTCTCTTACCg
GGAGGCTGAGGCGAGAGAATGGc
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3914
Chromosome17
Genomic Start Position7586251
Genomic End Position7586272
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.252
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -215.19
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ugAAGAGUAAAAGACCAAGGAa
;; ;; ;;;;;; ;;;;;
ttTTTTCTTTTTCTTTTTCCTa
aaAAAAGAAAAAGAAAAAGGAt
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4644
Chromosome17
Genomic Start Position7587015
Genomic End Position7587039
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.272
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -278.82
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gAAGACAG--AGAAAAGAGAGAGGu
;;;; ;; ;;;;;; ; ;;;;;
tTTCTTTCTTTCTTTTTTATCTCCt
aAAGAAAGAAAGAAAAAATAGAGGa
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4728-5p
Chromosome17
Genomic Start Position7587474
Genomic End Position7587499
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.196
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -354.85
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
acGAACG-ACGG-AGAG-GGGAGGGu
$$$ $ $ $$ $$$$ $$$$$$
tcGAAAGTAGGGTAGAGCCGGAGGGt
agCTTTCATCCCATCTCGGCCTCCCa
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-483-5p
Chromosome17
Genomic Start Position7587485
Genomic End Position7587510
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.208
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -347.46
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GA-GGGAAGAAAG---GAGGGCAGAA
$$ $$$$ $$$$$ $$$$ $$ $
GATGGGATGAAAGCTTGAGGCCAGCA
CTACCCTACTTTCGAACTCCGGTCGT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4739
Chromosome17
Genomic Start Position7589003
Genomic End Position7589028
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.216
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -352.47
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ucccgGGGAGG-CGAGGAGGAGGGAa
;;;;;; ;;;; ;; ;;;
tgaaaCCCTCCGGCTCCGCCCGCCTa
actttGGGAGGCCGAGGCGGGCGGAt
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-5196-5p
Chromosome17
Genomic Start Position7589118
Genomic End Position7589142
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.180
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -362.24
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGGUUGGGA---GCAGGGGAAGGGA
$$$ $$$$ $ $$$$$$ $$
GGGTCGGGAATCGACTGGGAAGAGA
CCCAGCCCTTAGCTGACCCTTCTCT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4668-5p
Chromosome17
Genomic Start Position7589613
Genomic End Position7589635
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.276
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -198.03
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cuguuuAGGAAAAAAAAAAGGGA
; ;;;;;;;;;;; ;;;
tacccaTTCTTTTTTTTTTTCCT
atgggtAAGAAAAAAAAAAAGGA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4668-5p
Chromosome17
Genomic Start Position7589619
Genomic End Position7589641
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.276
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -198.03
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cuguuuAGGAAAAAAAAAAGGGA
;;;;;;;;;;;;; ; ;
agggccTCCTTTTTTTTTTTCTT
tcccggAGGAAAAAAAAAAAGAA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-197-5p
Chromosome17
Genomic Start Position7589680
Genomic End Position7589705
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.172
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -362.24
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGAGGG--UGACGGGAG-AGAUGGgc
;;;;;; ;; ; ; ; ;;; ;;
CCTCCCTTTCTTCACACGTCTTCCgt
GGAGGGAAAGAAGTGTGCAGAAGGca
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-483-5p
Chromosome17
Genomic Start Position7589689
Genomic End Position7589712
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.252
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -347.46
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GAGGGAAGAAA-GGAGGG-CAGAa
; ; ;;;;;;; ;;;;;; ;;;
CACACTTCTTTCCCTCCCTGTCTc
GTGTGAAGAAAGGGAGGGACAGAg
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-5196-5p
Chromosome17
Genomic Start Position7589734
Genomic End Position7589759
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.144
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -379.4
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGGUUGGGAG--CAGGGGAAG--GGA
$$$ $$$ $ $$ $$$ $ $$$
GGGTGGGGCGCCCAGCGGACGTTGGA
CCCACCCCGCGGGTCGCCTGCAACCT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4728-5p
Chromosome17
Genomic Start Position7589912
Genomic End Position7589934
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.252
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -300.99
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
acgAACGACGGAGAGGGGAGGGu
;; ;; ;;;;; ;;;;;;
catTTTCTCTCTCTCTCCTCCCc
gtaAAAGAGAGAGAGAGGAGGGg
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4667-5p
Chromosome17
Genomic Start Position7589914
Genomic End Position7589937
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.236
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -310.76
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ccAAGAG-GA-AGACGAGGGGuca
;;;;; ;; ;;; ;;;;;;
ttTTCTCTCTCTCTCCTCCCCtct
aaAAGAGAGAGAGAGGAGGGGaga
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-423-5p
Chromosome17
Genomic Start Position7589915
Genomic End Position7589937
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.264
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -318.15
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
uuucAGAGCGAGAGACGGGGAGu
;;;; ;;;;; ;;;;;;
tttcTCTCTCTCTCCTCCCCTCt
aaagAGAGAGAGAGGAGGGGAGa
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-483-5p
Chromosome17
Genomic Start Position7589916
Genomic End Position7589938
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.268
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -320.53
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gAGGGA-AGAAAGGAGGGCAGAa
;; ;; ;;; ;;;;;;; ;;;
tTCTCTCTCTCTCCTCCCCTCTc
aAGAGAGAGAGAGGAGGGGAGAg
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4739
Chromosome17
Genomic Start Position7589918
Genomic End Position7589943
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.248
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -345.08
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ucccgGGGAGGCGAGGAG-GAGGGAa
; ;;;; ;;;;;; ;;; ;;
ggctaCTCTCCCCTCCTCTCTCTCTc
ccgatGAGAGGGGAGGAGAGAGAGAg
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-762
Chromosome17
Genomic Start Position7590591
Genomic End Position7590612
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.196
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -377.02
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cGAGCCGGGGCCGGGGUCGGGG
; ; ;;;; ;;;; ;;;;
cCACTGCCCCACCCCCAGCCCC
gGTGACGGGGTGGGGGTCGGGG
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4739
Chromosome17
Genomic Start Position7590952
Genomic End Position7590976
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.244
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -325.54
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ucccggGGAGGCGAGGAGGAGGGaa
$$$$ $ $$$$$$$$$
ggaaatGGAGTTGGGGAGGAGGGtg
cctttaCCTCAACCCCTCCTCCCac
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4739
Chromosome17
Genomic Start Position7590955
Genomic End Position7590979
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.240
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -335.31
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ucccgGGGAGGCGAGGAGGAGGGAA
$$$$$$ $ $$ $$$$ $$
gacgtGGGAGGAGGGGTTGAGGTAA
ctgcaCCCTCCTCCCCAACTCCATT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3154
Chromosome17
Genomic Start Position7590959
Genomic End Position7590980
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.228
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -335.31
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
AGACGAGGGUUGAGGGGAAGAc
$$$ $ $$$ $$$$$$ $$
AGACGTGGGAGGAGGGGTTGAg
TCTGCACCCTCCTCCCCAACTc
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-483-5p
Chromosome17
Genomic Start Position7591106
Genomic End Position7591127
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.248
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -310.76
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GAGGGAAGAAAGGAGGGCAGAA
$$ $$$$ $$$$ $$$ $$ $
GAAAGAAGGAAGGTGGGAAGTA
CTTTCTTCCTTCCACCCTTCAT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-197-5p
Chromosome17
Genomic Start Position7591815
Genomic End Position7591839
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.176
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -362.24
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGAGG-GUGACG-GGAGAGAUGGGc
; ;;; ; ; ; ;;;;;; ;;;
CGTCCGCTGTTCGCCTCTCCTCCCg
GCAGGCGACAAGCGGAGAGGAGGGc
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-483-5p
Chromosome17
Genomic Start Position7591867
Genomic End Position7591889
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.240
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -318.15
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GAGGGAAG-AAAGGAGGGcagaa
$$$$$$$$ $ $$$ $$$
GAGGGAAGCACAGGTGGGtttct
CTCCCTTCGTGTCCACCCaaaga
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-5196-5p
Chromosome17
Genomic Start Position7592034
Genomic End Position7592058
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.192
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -379.4
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGGUUGGGAGCAGGG---GAAGGGa
;;; ;; ;; ;;; ;;;;;;
CCCATCCTTCTCCCCACGCTTCCCc
GGGTAGGAAGAGGGGTGCGAAGGGg
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-197-5p
Chromosome17
Genomic Start Position7592036
Genomic End Position7592058
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.216
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -352.47
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGAGGGUGACGGGAGAGAUGGGc
; ;;; ;; ;;; ; ;; ;;;
CATCCTTCTCCCCACGCTTCCCc
GTAGGAAGAGGGGTGCGAAGGGg
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4739
Chromosome17
Genomic Start Position7592037
Genomic End Position7592062
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.204
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -352.47
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ucccGGGGAGGCGAGGAG-GAGGGAa
;;;;; ; ; ;; ; ;; ;;;
gtagCCCCTTCGCACCCCTCTTCCTa
catcGGGGAAGCGTGGGGAGAAGGAt
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3147
Chromosome17
Genomic Start Position7592410
Genomic End Position7592436
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.156
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -379.4
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
AGUGUGG---GAGGAGUGACGGGUUGG
$$ $ $$ $$$$ $ $$ $ $ $$
AGAGGGGTCTGAGGTGTGAGGTGACGG
TCTCCCCAGACTCCACACTCCACTGCC
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4728-5p
Chromosome17
Genomic Start Position7592881
Genomic End Position7592903
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.244
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -274.06
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
acGAACGACGGAGAGGGGAgggu
;;; ;; ;;;;;;;;;
agCTTTCTAACTCTCCCCTgttt
tcGAAAGATTGAGAGGGGAcaaa
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4459
Chromosome17
Genomic Start Position7592986
Genomic End Position7593007
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.252
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -318.15
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gAGGUGGAGGAGGCGGAGGAcc
$$$ $$$ $$$$ $$$$ $
aAGGTGGACGAGGGGGAGTAcc
tTCCACCTGCTCCCCCTCATgg
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4459
Chromosome17
Genomic Start Position7592990
Genomic End Position7593011
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.244
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -308.38
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GAGGUGGAGGAGGCGGAggacc
$$$$ $$$$ $$$ $$$
GAGGGGGAGCAGGTGGAatatg
CTCCCCCTCGTCCACCTtatac
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4459
Chromosome17
Genomic Start Position7594606
Genomic End Position7594630
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.196
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -372.01
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GAG-GUGGAG-GAGGCGGAG-GAcc
$$$ $ $$$$ $$$ $$$$ $$
GAGTGGGGAGACAGGGGGAGTGAac
CTCACCCCTCTGTCCCCCTCACTtg
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-5196-5p
Chromosome17
Genomic Start Position7594608
Genomic End Position7594630
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.212
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -362.24
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GGGUUGGGAG-CAGGGGAAGGGA
$ $ $$$$$ $$$$$ $$ $$
GAGTGGGGAGACAGGGGGAGTGA
CTCACCCCTCTGTCCCCCTCACT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4459
Chromosome17
Genomic Start Position7594611
Genomic End Position7594634
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.232
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -372.01
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GAGGUGGA-GGAGGCG-GAGGAcc
$$$$ $$$ $$$$ $ $$$$$
GAGGGGGACAGAGGGGTGAGGAca
CTCCCCCTGTCTCCCCACTCCTgt
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4459
Chromosome17
Genomic Start Position7595228
Genomic End Position7595249
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.220
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -342.7
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
GAGGUGGAGGAGGCGGAGGacc
; ;; ; ;;;;; ;;;;;
CACCGCAACCTCCGCCTCCcag
GTGGCGTTGGAGGCGGAGGgtc
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-483-3p
Chromosome17
Genomic Start Position7567613
Genomic End Position7567634
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.216
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -349.74
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
uUCUGCCCUCCUC-UCCUCACu
;;; ;;; ;;;; ;;;; ;
aTCTGCCCGCCTCAGCCTCCCa
tAGACGGGCGGAGTCGGAGGGt
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4769-3p
Chromosome17
Genomic Start Position7567614
Genomic End Position7567637
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.212
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -349.74
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
caucCCCUCC--CUCCUACCGUCU
;;;;;; ;;;; ;; ;;;
gaaaCCCTCCGACTCCGCCCGTCT
ctttGGGAGGCTGAGGCGGGCAGA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3613-5p
Chromosome17
Genomic Start Position7568697
Genomic End Position7568718
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.260
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -159.04
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cUUGUUUUUUUUUUCAUGUUGU
$$ $$$$$$$$$$ $ $$ $
cAAAAAAAAAAAAAAAAAAAAA
gTTTTTTTTTTTTTTTTTTTTT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3613-5p
Chromosome17
Genomic Start Position7568698
Genomic End Position7568719
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.260
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -159.04
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cUUGUUUUUUUUUUCAUGUUGU
$$ $$$$$$$$$$ $ $$ $
cAAAAAAAAAAAAAAAAAAAAA
gTTTTTTTTTTTTTTTTTTTTT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3613-5p
Chromosome17
Genomic Start Position7569111
Genomic End Position7569132
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.260
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -177.28
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cUUGUUUUUUUUUUCAUGUUGU
$$ $$$$$ $$$$$ $ $$ $
aAAAAAAAAGAAAAGAAAAAGA
tTTTTTTTTCTTTTCTTTTTCT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3613-5p
Chromosome17
Genomic Start Position7569113
Genomic End Position7569134
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.260
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -177.28
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cUUGUUUUUUUUUUCAUGUUGU
$$ $$$$$ $$$$$ $ $$ $
aAAGAAAAAGAAAAGAAAAAAA
tTTCTTTTTCTTTTCTTTTTTT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3613-5p
Chromosome17
Genomic Start Position7570571
Genomic End Position7570592
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.280
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -187.22
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
CUUGUUUUUUUUUUCAUGUUGU
$$$ $$$$$$$$$$ $ $$ $
GAAAAAAAAAAAAATTAAAAAA
CTTTTTTTTTTTTTAATTTTTT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3613-5p
Chromosome17
Genomic Start Position7570578
Genomic End Position7570599
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.256
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -157.4
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cUUGUUUUUUUUUUCAUguugu
$$ $$$$$$$$$$$ $
tAAAAAAAAAAAAAGGAagctc
aTTTTTTTTTTTTTCCTtcgag
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4685-3p
Chromosome17
Genomic Start Position7570619
Genomic End Position7570641
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.236
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -323.2
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaUCGGUCCC-GUCCUUCCCUCU
$$ $$$$ $$$$$ $$$$$
cgAGTCAGGGACAGGAACGGAGA
gcTCAGTCCCTGTCCTTGCCTCT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4769-3p
Chromosome17
Genomic Start Position7570939
Genomic End Position7570960
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.232
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -321.56
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
CAUCCCCUCCCUCCUACCgucu
$ $ $$$$ $$$$$$ $$
GAACGGGAAGGAGGAGGGacca
CTTGCCCTTCCTCCTCCCtggt
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1249
Chromosome17
Genomic Start Position7571025
Genomic End Position7571048
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.212
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -367.98
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCUUCUUCC--CCCCCUUCCCgca
;; ;; ;; ;;;;; ;;;;
cCTGCTCCCAGCCCCCCTCCCtgg
gGACGAGGGTCGGGGGGAGGGacc
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-877-3p
Chromosome17
Genomic Start Position7571090
Genomic End Position7571113
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.196
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -377.92
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCCUCCUC-C--CUCUUCUCCU
;;;;;;;; ; ; ; ;;;;;
atCCCTCCTCTCAGCCCAACTCCT
taGGGAGGAGAGTCGGGTTGAGGA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3162-3p
Chromosome17
Genomic Start Position7571090
Genomic End Position7571113
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.164
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -367.98
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
acCCCUCACCUC--CCCAUC-CCU
;;;;; ;;; ;;; ; ;;;
atCCCTCCTCTCAGCCCAACTCCT
taGGGAGGAGAGTCGGGTTGAGGA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-483-3p
Chromosome17
Genomic Start Position7571092
Genomic End Position7571112
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.240
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -331.5
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
uUCUGCCCUCCUCUCCUCACU
;; ;;; ;;;;;;;; ;;
cTCAACCCGACTCTCCTCCCT
gAGTTGGGCTGAGAGGAGGGA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3162-3p
Chromosome17
Genomic Start Position7571096
Genomic End Position7571118
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.232
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -396.16
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCCC--CUCACCUCCCCAUCCCu
;;; ;;; ;;;;;; ;;;;
aCCCGACTCTCCTCCCTATCCCa
tGGGCTGAGAGGAGGGATAGGGt
Match Typeindirect
Grade2
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3162-3p
Chromosome17
Genomic Start Position7571177
Genomic End Position7571201
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.148
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -367.98
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCCCCUC-ACCU---CCCCAUCCCu
$$$$$$ $$$ $$ $ $ $$
aGGGGAGTAGGACCCGGAGTACGGt
tCCCCTCATCCTGGGCCTCATGCCa
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4433-5p
Chromosome17
Genomic Start Position7571188
Genomic End Position7571211
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.164
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -367.98
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ugUCCU-CACCCC--CCACCCUGC
$$$$ $ $$$$ $ $$$$ $
ccAGGATGAGGGGATGCTGGGAAG
ggTCCTACTCCCCTACGACCCTTC
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1224-3p
Chromosome17
Genomic Start Position7571279
Genomic End Position7571302
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.196
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -359.68
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCU-CCUCUCUCC--UCCACCCC
;; ;;;;;;;;; ;; ;; ;
acCTACCTCTCTCCGGTCACCCTC
tgGATGGAGAGAGGCCAGTGGGAG
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1249
Chromosome17
Genomic Start Position7571457
Genomic End Position7571478
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.232
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -321.56
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCUUCUUCCCCCCCUUCCCgca
$$$$ $$$$$ $$ $$ $
aGAAGCAGGGGAGGGAGAGaac
tCTTCGTCCCCTCCCTCTCttg
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4769-3p
Chromosome17
Genomic Start Position7571461
Genomic End Position7571483
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.232
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -321.56
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
CAUCCCCUCCCUC-CUaccgucu
$ $$$$$$$$$$$ $$
GCAGGGGAGGGAGAGAaccttgt
CGTCCCCTCCCTCTCTtggaaca
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4769-3p
Chromosome17
Genomic Start Position7571497
Genomic End Position7571518
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.244
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -321.56
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
caucCCCUCCCUCCUACCGUCu
$$ $$$$$$$$ $$ $$
ggttGGCAGGGAGGAGGGGAGg
ccaaCCGTCCCTCCTCCCCTCc
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4769-3p
Chromosome17
Genomic Start Position7571497
Genomic End Position7571518
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.232
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -339.8
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
CAUCCCCUCCCUCCUACCgucu
$ $$$$$$$$ $$$ $$
GGAGGGGAGGAGGGACGGttgg
CCTCCCCTCCTCCCTGCCaacc
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-877-3p
Chromosome17
Genomic Start Position7571499
Genomic End Position7571520
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.216
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -349.74
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCCUCC-UCCCUCUUCUCCU
$$ $$ $$$$$$ $$ $$$
ttGGTTGGCAGGGAGGAGGGGA
aaCCAACCGTCCCTCCTCCCCT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4758-3p
Chromosome17
Genomic Start Position7571660
Genomic End Position7571685
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.140
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -367.98
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cuCCCAC-CAGUCGUCCAC--CCCGU
;;; ; ; ;; ;;; ; ;;; ;
tcCCCACTCACTCCTCCACGACCCTT
agGGGTGAGTGAGGAGGTGCTGGGAA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1281
Chromosome17
Genomic Start Position7571666
Genomic End Position7571683
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.220
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -339.8
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
CCCUCUC-CUCCUCCGCu
;;; ;;; ;;;;;;; ;
CCCACTCACTCCTCCACg
GGGTGAGTGAGGAGGTGc
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3162-3p
Chromosome17
Genomic Start Position7571669
Genomic End Position7571691
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.168
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -386.22
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCCCCUCAC-CUCCCCAUC-CCU
; ;;;; ; ; ;;;; ; ;;;
cCTCCTCACTCACCCCTGCACCT
gGAGGAGTGAGTGGGGACGTGGA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4646-3p
Chromosome17
Genomic Start Position7571790
Genomic End Position7571810
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.264
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -313.26
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCCUUCCCUCUCCCUGUUa
$$$ $$$ $$$$$$$ $$
aaGGGGAGGAAGAGGGAAAAa
ttCCCCTCCTTCTCCCTTTTt
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-328
Chromosome17
Genomic Start Position7571791
Genomic End Position7571814
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.236
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -331.5
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ugCCUUCCCGUC--UCUCCCgguc
$$$$$$$ $$ $$$$$$
tgGGAAGGGGAGGAAGAGGGaaaa
acCCTTCCCCTCCTTCTCCCtttt
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1237
Chromosome17
Genomic Start Position7571793
Genomic End Position7571813
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.232
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -321.56
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCCCCUGCCUCGUCUUCCu
$$$ $$ $$$$ $$$$$
aaGGGAGAAGGAGGGGAAGGg
ttCCCTCTTCCTCCCCTTCCc
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3162-3p
Chromosome17
Genomic Start Position7571793
Genomic End Position7571814
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.260
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -396.16
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
acCCCUC-ACCUCCCCAUCCCu
$$$$$ $$$$$$$ $$$$
aaGGGAGAAGGAGGGGAAGGGt
ttCCCTCTTCCTCCCCTTCCCa
Match Typedirect
Grade2
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3162-3p
Chromosome17
Genomic Start Position7571794
Genomic End Position7571814
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.240
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -349.74
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCCCCUCACCUCCCCAUCCCU
$$$ $$ $$$$$ $$$$$
tGGGAAGGGGAGGAAGAGGGA
aCCCTTCCCCTCCTTCTCCCT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-877-3p
Chromosome17
Genomic Start Position7571795
Genomic End Position7571815
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.232
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -321.56
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCCUCCUCCCUCUUCUCCu
$$$$ $ $$ $$$$$$$
gtGGGAAGGGGAGGAAGAGGg
caCCCTTCCCCTCCTTCTCCc
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1249
Chromosome17
Genomic Start Position7571795
Genomic End Position7571816
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.304
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -387.86
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCUUCUUCCCCCCCUUCCCGCa
$ $$$$$$ $$$$$$$$$ $
gGGAGAAGGAGGGGAAGGGTGg
cCCTCTTCCTCCCCTTCCCACc
Match Typedirect
Grade1
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1229
Chromosome17
Genomic Start Position7571797
Genomic End Position7571821
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.200
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -367.98
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gacaCCCUCCCGUCACCAC--UCUC
$$$ $$$ $$ $$ $ $$$$
agtgGGGTGGGAAGGGGAGGAAGAG
tcacCCCACCCTTCCCCTCCTTCTC
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-5196-3p
Chromosome17
Genomic Start Position7571798
Genomic End Position7571819
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.216
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -349.74
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCCUCCC-UCUGCUCCUACU
$$$ $$$ $$ $$$$$ $$
tgGGGTGGGAAGGGGAGGAAGA
acCCCACCCTTCCCCTCCTTCT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1234
Chromosome17
Genomic Start Position7571798
Genomic End Position7571820
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.180
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -386.22
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
CACCCCACCC-ACCAGUCCGGCU
$ $$$$ $$$ $$ $$$ $$
GTGGGGTGGGAAGGGGAGGAAGA
CACCCCACCCTTCCCCTCCTTCT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4769-3p
Chromosome17
Genomic Start Position7571798
Genomic End Position7571821
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.200
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -367.98
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cauCCCCUCCCU--CCUACCGUCU
$$$$ $$$$ $$ $$ $$$
agtGGGGTGGGAAGGGGAGGAAGA
tcaCCCCACCCTTCCCCTCCTTCT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1249
Chromosome17
Genomic Start Position7571803
Genomic End Position7571824
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.244
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -321.56
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
acUUCUUCCCCCCCUUCCCgca
$$$ $$$ $$$$$$$$
aaAAGTGGGGTGGGAAGGGgag
ttTTCACCCCACCCTTCCCctc
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4646-3p
Chromosome17
Genomic Start Position7571804
Genomic End Position7571825
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.228
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -331.5
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCCUUCCCUCUCC-CUGUUa
$$$$$$$$ $ $$ $$ $$
agGGGAAGGGTGGGGTGAAAAt
tcCCCTTCCCACCCCACTTTTa
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3613-5p
Chromosome17
Genomic Start Position7572147
Genomic End Position7572168
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.292
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -187.22
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cUUGUUUUUUUUUUCAUGUUGU
$$ $$$$$$$$$$$ $ $$ $
aAAAAAAAAAAAAAGAAAAAGA
tTTTTTTTTTTTTTCTTTTTCT
Match Typedirect
Grade2
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3613-5p
Chromosome17
Genomic Start Position7572159
Genomic End Position7572180
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.284
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -177.28
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cUUGUUUUUUUUUUCAUGUUgu
$$ $$$$$$$$$$$ $ $$
aAAAAAAAAAAAAAGAAAAAag
tTTTTTTTTTTTTTCTTTTTtc
Match Typedirect
Grade5
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4646-3p
Chromosome17
Genomic Start Position7572395
Genomic End Position7572415
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.268
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -266.84
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gacccUUCCCUCUCCCUGUUa
$$$$$$$$$$$$ $$
cgaacAAGGGAGAGGGACAAc
gcttgTTCCCTCTCCCTGTTg
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1224-3p
Chromosome17
Genomic Start Position7572720
Genomic End Position7572742
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.232
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -377.92
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCUCCUCUC--UCCUCCACCCC
;; ;;; ; ;;;;;; ;;;;
tcCTACTCCCCATCCTCCTCCCC
agGATGAGGGGTAGGAGGAGGGG
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3162-3p
Chromosome17
Genomic Start Position7572720
Genomic End Position7572743
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.216
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -406.1
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCCCCU-CACCUCCCCAUC--CCU
;;;;; ; ;;; ;;; ;; ;;;
aCCCCTCCTCCTACCCCTCATCCT
tGGGGAGGAGGATGGGGAGTAGGA
Match Typeindirect
Grade2
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1249
Chromosome17
Genomic Start Position7572721
Genomic End Position7572745
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.184
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -396.16
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCUUCUUCCC--CC-CCUUCCCGCa
;; ;; ;;; ;; ;;; ;;; ;
cCTACTCCCCATCCTCCTCCCCACa
gGATGAGGGGTAGGAGGAGGGGTGt
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4728-3p
Chromosome17
Genomic Start Position7572721
Genomic End Position7572745
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.216
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -349.74
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gacCCCGUCCUCCCUCCAGUCGUAC
;;; ;;;;;; ;; ;; ; ;
acaCCCCTCCTCCTACCCCTCATCC
tgtGGGGAGGAGGATGGGGAGTAGG
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4749-3p
Chromosome17
Genomic Start Position7572723
Genomic End Position7572744
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.212
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -386.22
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCACCCC--CGUCCUCCCCGC
; ;;;; ; ;;;;;;;; ;
taCTCCCCATCCTCCTCCCCAC
atGAGGGGTAGGAGGAGGGGTG
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-483-3p
Chromosome17
Genomic Start Position7572723
Genomic End Position7572745
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.200
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -359.68
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
UUCUGCCC-UCCU-CUCCUCACu
; ;; ;;; ;;;; ;;;; ; ;
TACTCCCCATCCTCCTCCCCACa
ATGAGGGGTAGGAGGAGGGGTGt
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4749-3p
Chromosome17
Genomic Start Position7572725
Genomic End Position7572746
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.192
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -386.22
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCACCCC-CGUCCU-CCCCGC
; ;;;; ; ;;;; ;;;; ;
aaCACCCCTCCTCCTACCCCTC
ttGTGGGGAGGAGGATGGGGAG
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4728-3p
Chromosome17
Genomic Start Position7572865
Genomic End Position7572890
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.232
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -339.8
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCCCGUC-CUCCCUCCagucguac
$$$$ $$ $$$$$$$$
tgGGGGTAGAGAGGGAGGggacggta
acCCCCATCTCTCCCTCCcctgccat
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1228-3p
Chromosome17
Genomic Start Position7572868
Genomic End Position7572889
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.192
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -358.04
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
CCCCC--CGCUCCGUCCACacu
$$$$$ $ $$$$ $$$ $
GGGGGTAGAGAGGGAGGGGacg
CCCCCATCTCTCCCTCCCCtgc
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4769-3p
Chromosome17
Genomic Start Position7572868
Genomic End Position7572890
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.260
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -377.92
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
CAUCCCCUCCCUC-CUACCgucu
$ $$$$$$$$$$$ $$ $$
GCAGGGGAGGGAGAGATGGgggt
CGTCCCCTCCCTCTCTACCccca
Match Typedirect
Grade2
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4667-3p
Chromosome17
Genomic Start Position7572871
Genomic End Position7572891
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.232
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -321.56
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCACCCCUGUCUUCCUCCCu
$ $$$ $ $$$ $$$$$$
gtGGGGGTAGAGAGGGAGGGg
caCCCCCATCTCTCCCTCCCc
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1224-3p
Chromosome17
Genomic Start Position7572872
Genomic End Position7572894
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.224
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -377.92
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCU-CCUCUCU-CCUCCACCCc
$$ $$$$$$$ $$ $$ $$$
ggGAGGGAGAGATGGGGGTGGGa
ccCTCCCTCTCTACCCCCACCCt
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3162-3p
Chromosome17
Genomic Start Position7572874
Genomic End Position7572894
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.220
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -358.04
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
acCCCUCACCUCCCCAUCCCU
$$$$$ $ $$$$ $$$$
gaGGGAGAGATGGGGGTGGGA
ctCCCTCTCTACCCCCACCCT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4723-3p
Chromosome17
Genomic Start Position7572876
Genomic End Position7572897
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.232
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -339.8
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aaacCCCUCCUCGGUCUCUCCC
$$$ $$ $ $$$$$$$$
cggaGGGTGGGGGTAGAGAGGG
gcctCCCACCCCCATCTCTCCC
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4667-3p
Chromosome17
Genomic Start Position7573010
Genomic End Position7573030
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.244
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -285.08
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gacaCCCCUGUCUUCCUCCCU
$$ $$ $$$$$ $$$$$
tgtaGGAGACAGAAGCAGGGA
acatCCTCTGTCTTCGTCCCT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1236
Chromosome17
Genomic Start Position7573012
Genomic End Position7573035
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.232
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -323.2
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCUCUCUGUUC--CCCUUCUCc
$$$$$ $ $$$ $$$$ $$$
taGGAGACAGAAGCAGGGAGGAGa
atCCTCTGTCTTCGTCCCTCCTCt
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4769-3p
Chromosome17
Genomic Start Position7573016
Genomic End Position7573037
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.240
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -313.26
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
caUCCCCUCCCUCCUACCGUCU
$$ $$$$$$$ $$ $ $$$
agAGAGGAGGGACGAAGACAGA
tcTCTCCTCCCTGCTTCTGTCT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-877-3p
Chromosome17
Genomic Start Position7573017
Genomic End Position7573038
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.252
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -313.26
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCCUCCUCCCU-CUUCUccu
$ $$$$$$$$$ $$$$$
taGAGAGGAGGGACGAAGAcag
atCTCTCCTCCCTGCTTCTgtc
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4279
Chromosome17
Genomic Start Position7573021
Genomic End Position7573036
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.256
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -303.32
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
CUUCGGCCCUCCUCUC
$$$$ $$$$$$$$$$
GAAGCAGGGAGGAGAG
CTTCGTCCCTCCTCTC
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1249
Chromosome17
Genomic Start Position7573503
Genomic End Position7573526
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.188
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -367.98
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCUUCUUCC--CCCCCUUCCCGCa
;; ; ;; ;;;;;;; ;; ;
aCTGCGCCCGGCCCCCTTACCCCa
tGACGCGGGCCGGGGGAATGGGGt
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-328
Chromosome17
Genomic Start Position7573881
Genomic End Position7573905
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.184
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -359.68
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ugCCUUCC--CGUCUC-UCCCGGUC
$$$$$$ $ $$$ $$$$ $$
taGGAAGGCAGGGGAGTAGGGCCAG
atCCTTCCGTCCCCTCATCCCGGTC
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4769-3p
Chromosome17
Genomic Start Position7573888
Genomic End Position7573914
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.176
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -377.92
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
CAUCCCC---UCCC--UCCUACCgucu
$ $$$$$ $$$$ $$$$ $$
GCAGGGGAGTAGGGCCAGGAAGGggct
CGTCCCCTCATCCCGGTCCTTCCccga
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-877-3p
Chromosome17
Genomic Start Position7573890
Genomic End Position7573913
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.208
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -359.68
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCCUCCUCCC--U-CUUCUCCu
$$$$$ $$$$ $ $$$$ $$
agGGGAGTAGGGCCAGGAAGGGGc
tcCCCTCATCCCGGTCCTTCCCCg
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1249
Chromosome17
Genomic Start Position7573934
Genomic End Position7573960
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.208
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -387.86
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCUUCUUC---CCCCCCU--UCCCgca
;;;; ;; ;;;;;;; ;;;;
cCTTCCTCGGTCCCCCCTCGTCCCgag
gGAAGGAGCCAGGGGGGAGCAGGGctc
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-877-3p
Chromosome17
Genomic Start Position7573935
Genomic End Position7573957
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.232
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -359.68
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCCUCCUCCCUCUU--CUCCU
;;;; ;;;;; ; ; ;;;;;
agCCCTGCTCCCCCCTGGCTCCT
tcGGGACGAGGGGGGACCGAGGA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1236
Chromosome17
Genomic Start Position7573938
Genomic End Position7573962
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.184
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -359.68
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCU--CUCUGUUCCCCUUC-UCC
;;; ;;; ; ;;;; ;; ;;;
acCCTTCCTCGGTCCCCCCTCGTCC
tgGGAAGGAGCCAGGGGGGAGCAGG
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1249
Chromosome17
Genomic Start Position7573938
Genomic End Position7573964
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.196
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -377.92
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCUUCUUCCCCC-----CCUUCCCgca
;; ;; ;;;;; ;;;;;;;
cCTGCTCCCCCCTGGCTCCTTCCCagc
gGACGAGGGGGGACCGAGGAAGGGtcg
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1249
Chromosome17
Genomic Start Position7574042
Genomic End Position7574064
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.228
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -331.5
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCUU-CUUCCCCCCCUUCCCgca
$$$ $$$$ $$$$$$ $ $
tGAATGAAGAGGGGGAGGAGaca
aCTTACTTCTCCCCCTCCTCtgt
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-483-3p
Chromosome17
Genomic Start Position7574429
Genomic End Position7574450
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.216
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -349.74
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
uUCUGCCCUCCU-CUCCUCACu
;;; ;;; ;;; ; ;;;; ;
aTCTACCCACCTCCACCTCCCa
tAGATGGGTGGAGGTGGAGGGt
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4769-3p
Chromosome17
Genomic Start Position7574430
Genomic End Position7574453
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.212
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -349.74
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
caucCCCUC--CCUCCUACCGUCU
;;;;; ;;;;; ;; ;;;
gaaaCCCTCCACCTCCACCCATCT
ctttGGGAGGTGGAGGTGGGTAGA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1306-5p
Chromosome17
Genomic Start Position7575808
Genomic End Position7575832
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.160
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -367.98
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCCUGCAAACGUC---CCCUCCACC
$$$ $ $ $$ $$$$$$ $$
aGGATGGATGGAGCCTGGGAGGTGG
tCCTACCTACCTCGGACCCTCCACC
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3613-5p
Chromosome17
Genomic Start Position7576442
Genomic End Position7576463
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.272
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -177.28
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
CUUGUUUUUUUUUUCAUGUUgu
$$$ $$$$$$$$$$ $ $$
GAAAAAAAAAAAAAAAAAAAcc
CTTTTTTTTTTTTTTTTTTTgg
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3613-5p
Chromosome17
Genomic Start Position7576449
Genomic End Position7576470
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.256
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -157.4
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cUUGUUUUUUUUUUCAUguugu
$$ $$$$$$$$$$$ $
aAAAAAAAAAAAAAGCAggcta
tTTTTTTTTTTTTTCGTccgat
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1913
Chromosome17
Genomic Start Position7576979
Genomic End Position7577002
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.188
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -359.68
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCCGUCGUCGCCUCC-CC-CGUCU
;; ; ;; ;;;;; ;; ; ;;;
cCCTTGGTCTCCTCCACCGCTTCT
gGGAACCAGAGGAGGTGGCGAAGA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-877-3p
Chromosome17
Genomic Start Position7576986
Genomic End Position7577008
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.224
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -341.44
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gacCCUCCUCC-C-UCUUCUCCU
;;;;; ;; ; ;;;; ;;;;
tctCCTCCACCGCTTCTTGTCCT
agaGGAGGTGGCGAAGAACAGGA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-877-3p
Chromosome17
Genomic Start Position7577081
Genomic End Position7577105
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.172
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -369.62
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCCUC-CU-CCCUC-U-UCUCCU
;;;;; ;; ;; ; ; ;;;;;;
gaCCCTCTCTGGCCGCGTGTCTCCT
ctGGGAGAGACCGGCGCACAGAGGA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1224-3p
Chromosome17
Genomic Start Position7577229
Genomic End Position7577253
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.172
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -377.92
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCUCC-UCU-CUCC--UCCACCCc
;;;; ;;; ;;;; ;; ;;;
ggCTCCATCTACTCCCAACCACCCt
ccGAGGTAGATGAGGGTTGGTGGGa
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-877-3p
Chromosome17
Genomic Start Position7577232
Genomic End Position7577254
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.212
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -377.92
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCCUCC-UCCCUCUUCU-CCU
;;; ;; ;;;;; ;;; ;;;
ttCCCACCAACCCTCATCTACCT
aaGGGTGGTTGGGAGTAGATGGA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-877-3p
Chromosome17
Genomic Start Position7578262
Genomic End Position7578284
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.244
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -341.44
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCCUCCUC--CCUCUUCUCCu
$$$$$$$$ $ $$$$ $$$
cgGGGAGGAGTCGTAGAATAGGc
gcCCCTCCTCAGCATCTTATCCg
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3162-3p
Chromosome17
Genomic Start Position7578456
Genomic End Position7578479
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.144
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -376.28
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCCCCUCAC--CUCCC-CAUCCcu
$$$$ $ $ $ $$$ $ $$$
gGGGGCGGGCCGTGGGCGCAGGcg
cCCCCGCCCGGCACCCGCGTCCgc
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4436b-5p
Chromosome17
Genomic Start Position7578543
Genomic End Position7578569
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.172
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -369.62
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
CCGUCCCGUC----CGU-CUUCACCUg
$$ $$$$ $$ $ $ $$$$ $$$
GGCAGGGGAGTACTGTAGGAAGAGGAa
CCGTCCCCTCATGACATCCTTCTCCTt
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3613-5p
Chromosome17
Genomic Start Position7578704
Genomic End Position7578725
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.264
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -167.34
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cUUGUUUUUUUUUUCAUGUugu
;; ;;;;;;;;;;; ; ;
tTTTTTTTTTTTTTCTTTTcga
aAAAAAAAAAAAAAGAAAAgct
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3613-5p
Chromosome17
Genomic Start Position7578708
Genomic End Position7578729
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.260
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -159.04
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cUUGUUUUUUUUUUCAUGUUGU
;; ;;;;;;;;;; ; ;; ;
tTTCTTTTTTTTTTTTTTTTTT
aAAGAAAAAAAAAAAAAAAAAA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-877-3p
Chromosome17
Genomic Start Position7579081
Genomic End Position7579107
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.160
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -369.62
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCCUC-CUCCCUC----U-UCUCCU
$$ $$ $ $$$$$ $ $$$$$$
agGGTAGTGTGGGAGTCGTAGAGAGGA
tcCCATCACACCCTCAGCATCTCTCCT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3173-5p
Chromosome17
Genomic Start Position7579102
Genomic End Position7579123
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.248
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -268.48
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
UUUCCUCUUUUGUCCGUCCCGU
$$$ $$$$$ $$$ $$$$ $
AAACCCGAAAATAGGTAGGGTA
TTTGGGCTTTTATCCATCCCAT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-877-3p
Chromosome17
Genomic Start Position7579399
Genomic End Position7579424
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.196
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -369.62
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCCUCCU---CCC--UCUUCUCCU
$$$$$$$ $$$ $$ $$$ $$
ggGGGAGGACCGGGGACAGTAGAAGA
ccCCCTCCTGGCCCCTGTCATCTTCT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3162-3p
Chromosome17
Genomic Start Position7579415
Genomic End Position7579437
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.192
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -386.22
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCCCCU-CACC-UCCCCAUCCcu
$$$$$ $ $$ $$$$ $$$
cGGGGACGTGGTCGGGGGAGGac
gCCCCTGCACCAGCCCCCTCCtg
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3162-3p
Chromosome17
Genomic Start Position7579627
Genomic End Position7579648
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.172
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -376.28
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCCCCUCACCUCCCCAUC-CCU
;;;; ; ; ;;;; ; ;;;
aCCCCCCGACCCCCCGACTCCT
tGGGGGGCTGGGGGGCTGAGGA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3162-3p
Chromosome17
Genomic Start Position7579633
Genomic End Position7579653
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.208
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -376.28
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCCCCUCACCUCCCCAUCCCU
;;;; ; ; ;;;; ;;;;
gCCCCCCAGCCCCCCAGCCCT
cGGGGGGTCGGGGGGTCGGGA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3162-3p
Chromosome17
Genomic Start Position7579659
Genomic End Position7579680
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.204
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -367.98
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCCCCU-CACCUCCCCAUCCCU
;;;;; ;;;;;; ;;;;
aCCCCTGGACCTCCCGACCCCT
tGGGGACCTGGAGGGCTGGGGA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3162-3p
Chromosome17
Genomic Start Position7579784
Genomic End Position7579805
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.184
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -394.52
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCCCCUCACC-UCCCCAUCCCu
$$$$ $ $$ $$$$ $$$
gGGGGTGGGGTTGGGGTCGGGg
cCCCCACCCCAACCCCAGCCCc
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3162-3p
Chromosome17
Genomic Start Position7580125
Genomic End Position7580145
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.232
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -358.04
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCCCCUCACCUCCCCAUCCcu
;; ;;; ;; ;;;; ;;;
aCCACTCCCCACCCCGTCCtc
tGGTGAGGGGTGGGGCAGGag
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3162-3p
Chromosome17
Genomic Start Position7580130
Genomic End Position7580150
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.208
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -358.04
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCCCCUCACCUCCCCAUCCCU
;;;; ; ;;;; ;; ;; ;
gCCCCACCCCTCACCAGCCAT
cGGGGTGGGGAGTGGTCGGTA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4769-3p
Chromosome17
Genomic Start Position7580133
Genomic End Position7580158
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.140
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -377.92
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cauCCCCUC-CC-UCC-UAC-CGUCU
;;;;;; ;; ;; ; ; ; ;;;
ccaCCCCTCACCAGCCATGCACTTCT
ggtGGGGAGTGGTCGGTACGTGAAGA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1249
Chromosome17
Genomic Start Position7580229
Genomic End Position7580255
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.176
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -387.86
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
acUUCUUCCC-C--CCCU--UCCCGCa
; ;;;;;; ; ;;;; ;;;; ;
tgTCCTTCCCTCAACCCTTATCCCACg
acAGGAAGGGAGTTGGGAATAGGGTGc
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-877-3p
Chromosome17
Genomic Start Position7580545
Genomic End Position7580565
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.232
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -321.56
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gacCCUCCUCCCUCUUCUCCU
;;;;; ;;;;; ;; ; ;
tgtCCTCCACCCTCGTCCCGT
acaGGAGGTGGGAGCAGGGCA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3162-3p
Chromosome17
Genomic Start Position7580617
Genomic End Position7580640
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.184
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -386.22
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCCCCU---CACCUCCCCAUCCCu
;;;;; ; ;; ;;; ;;;;
cCCCCTTGGCCCCCACCCTTCCCc
gGGGGAACCGGGGGTGGGAAGGGg
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-877-3p
Chromosome17
Genomic Start Position7580617
Genomic End Position7580641
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.160
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -367.98
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCCU--CCUCCCUC--UUCUCCu
;;;; ;; ;;; ; ;;; ;;
acCCCTTCCCACCCCCGGTTCCCCc
tgGGGAAGGGTGGGGGCCAAGGGGg
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1249
Chromosome17
Genomic Start Position7580620
Genomic End Position7580642
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.228
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -349.74
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCUUCUUCCCC-CCCUUCCCgca
;;; ;;;; ;;;;;;;;
cCTTGGCCCCCACCCTTCCCcac
gGAACCGGGGGTGGGAAGGGgtg
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4646-3p
Chromosome17
Genomic Start Position7580621
Genomic End Position7580641
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.232
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -321.56
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCCUUCCCUCUCCCUGUUa
;;;;;;;; ; ;;; ;;
acCCCTTCCCACCCCCGGTTc
tgGGGAAGGGTGGGGGCCAAg
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1249
Chromosome17
Genomic Start Position7580629
Genomic End Position7580650
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.240
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -349.74
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCUUCUUCCCCCCCUUCCCGCa
; ; ;;; ;;;;;;;;; ;
aCATAGTCCACCCCTTCCCACc
tGTATCAGGTGGGGAAGGGTGg
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3613-5p
Chromosome17
Genomic Start Position7581769
Genomic End Position7581790
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.264
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -167.34
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cuugUUUUUUUUUUCAUGUUGU
;;;;;;;;;;; ; ;; ;
aggtTTTTTTTTTTCTTTTTCT
tccaAAAAAAAAAAGAAAAAGA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3162-3p
Chromosome17
Genomic Start Position7582011
Genomic End Position7582033
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.204
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -367.98
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
acCCCUC-ACCUCC-CCAUCCcu
;;;;; ;;;;; ;; ;;;
aaCCCTCAGCCTCCGCCCTCCta
ttGGGAGTCGGAGGCGGGAGGat
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4753-3p
Chromosome17
Genomic Start Position7582127
Genomic End Position7582148
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.260
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -232.0
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
UGUGUUCCGAUUUCUUUCUCUu
; ; ;; ; ;;;;;;;;;;;
TTTTTTTCTTTTTCTTTCTCTc
AAAAAAAGAAAAAGAAAGAGAg
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3613-5p
Chromosome17
Genomic Start Position7582134
Genomic End Position7582155
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.312
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -215.4
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
CUUGUUUUUUUUUUCAUGUUGU
;;; ;;;;;;;;;;; ; ;; ;
CTTTTTTTTTTTTTCTTTTTCT
GAAAAAAAAAAAAAGAAAAAGA
Match Typeindirect
Grade2
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3613-5p
Chromosome17
Genomic Start Position7582141
Genomic End Position7582162
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.268
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -175.64
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
CUUGUUUUUUUUUUCauguugu
;;; ;;;;;;;;;;;
CTTTTTTTTTTTTTCagggatg
GAAAAAAAAAAAAAGtccctac
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3613-5p
Chromosome17
Genomic Start Position7582234
Genomic End Position7582255
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.260
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -159.04
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cUUGUUUUUUUUUUCAUGUUGU
;; ;;;;;;;;;; ; ;; ;
tTTTTTTTTTTTTTTGTCTTTT
aAAAAAAAAAAAAAACAGAAAA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1224-3p
Chromosome17
Genomic Start Position7582699
Genomic End Position7582725
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.160
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -377.92
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCUCCUCU--CU----CCUCCACCCc
;;;; ;; ;; ;;;;; ;;;
atCTCCGCTTACTGCAACCTCCTCCCg
taGAGGCGAATGACGTTGGAGGAGGGc
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-877-3p
Chromosome17
Genomic Start Position7582702
Genomic End Position7582726
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.224
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -397.8
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCCUCCUCC--C-UC-UUCUCCU
;;;;;;;;; ; ;; ;;; ;;;
ggCCCTCCTCCAACGTCATTCGCCT
ccGGGAGGAGGTTGCAGTAAGCGGA
Match Typeindirect
Grade2
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3613-5p
Chromosome17
Genomic Start Position7584481
Genomic End Position7584502
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.264
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -167.34
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cUUGUUUUUUUUUUCAUGUugu
;; ;;;;;;;;;;; ; ;
tTTTTTTTTTTTTTCCTTTctt
aAAAAAAAAAAAAAGGAAAgaa
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3613-5p
Chromosome17
Genomic Start Position7584488
Genomic End Position7584509
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.252
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -167.34
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
CUUGUUUUUUUUUUCAUGUugu
;;; ;;;;;;;;;; ; ;
CTTTTTTTTTTTTTTTTTTgac
GAAAAAAAAAAAAAAAAAActg
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-877-3p
Chromosome17
Genomic Start Position7584593
Genomic End Position7584614
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.240
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -313.26
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaccCUCCUCCCUCU-UCUCCU
;;;;; ;;;;; ;;;;;
gattCTCCTGCCTCTGCCTCCT
ctaaGAGGACGGAGACGGAGGA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-483-3p
Chromosome17
Genomic Start Position7585040
Genomic End Position7585061
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.216
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -349.74
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
uUCUGCCCUCCUC-UCCUCACu
;;; ;;; ;;;; ;;;; ;
aTCTGCCCACCTCGGCCTCCCa
tAGACGGGTGGAGCCGGAGGGt
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4769-3p
Chromosome17
Genomic Start Position7585041
Genomic End Position7585064
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.212
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -349.74
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
caucCCCUCC--CUCCUACCGUCU
;;;;;; ;;;; ;; ;;;
gaaaCCCTCCGGCTCCACCCGTCT
ctttGGGAGGCCGAGGTGGGCAGA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3613-5p
Chromosome17
Genomic Start Position7585109
Genomic End Position7585130
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.292
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -187.22
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cUUGUUUUUUUUUUCAUGUUGU
;; ;;;;;;;;;;; ; ;; ;
gTTTTTTTTTTTTTCTTTTTCT
cAAAAAAAAAAAAAGAAAAAGA
Match Typeindirect
Grade2
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1224-3p
Chromosome17
Genomic Start Position7585176
Genomic End Position7585202
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.160
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -406.1
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCUC--CUCUCU-C---CUCCACCCC
;;; ;;; ;; ; ;;;; ;;;;
atCTCAGCTCACTGCAAGCTCCGCCCC
taGAGTCGAGTGACGTTCGAGGCGGGG
Match Typeindirect
Grade2
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-335-3p
Chromosome17
Genomic Start Position7585405
Genomic End Position7585426
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.248
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -268.48
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
CCAGUCCUCGUUAUUACUUUUU
;; ;;;; ;; ;; ;;;;;;
CCGGCCCTCATTATTTCTTTTT
GGCCGGGAGTAATAAAGAAAAA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3613-5p
Chromosome17
Genomic Start Position7585518
Genomic End Position7585539
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.264
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -167.34
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cUUGUUUUUUUUUUCAUGUugu
;; ;;;;;;;;;;; ; ;
tTTTTTTTTTTTTTCTTTTctt
aAAAAAAAAAAAAAGAAAAgaa
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3613-5p
Chromosome17
Genomic Start Position7585525
Genomic End Position7585546
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.280
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -187.22
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
CUUGUUUUUUUUUUCAUGUUGU
;;; ;;;;;;;;;; ; ;; ;
CTTTTTTTTTTTTTTTTTTTTT
GAAAAAAAAAAAAAAAAAAAAA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4668-3p
Chromosome17
Genomic Start Position7586247
Genomic End Position7586269
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.268
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -193.88
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gacCUUUUUGUUUUUCCUaaaag
;;;;;; ;;;;;;;;
tttCTTTTTCTTTTTCCTattta
aaaGAAAAAGAAAAAGGAtaaat
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4668-3p
Chromosome17
Genomic Start Position7586251
Genomic End Position7586273
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.256
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -193.88
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCUUUUUGUUUUUCCUaaaag
;;;;;;; ;;;;;; ;
atCCTTTTTCTTTTTCTTttttt
taGGAAAAAGAAAAAGAAaaaaa
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3613-5p
Chromosome17
Genomic Start Position7586253
Genomic End Position7586274
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.252
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -167.34
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
cUUGUUUUUUUUUUCAUGUUgu
;; ;;;; ;;;;;; ; ;;
gTTTTTTTCTTTTTCTTTTTcc
cAAAAAAAGAAAAAGAAAAAgg
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-483-3p
Chromosome17
Genomic Start Position7586653
Genomic End Position7586674
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.216
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -349.74
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
uUCUGCCCUCCUC-UCCUCACu
;;; ;;; ;;;; ;;;; ;
aTCTGCCCACCTCGGCCTCCCa
tAGACGGGTGGAGCCGGAGGGt
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4769-3p
Chromosome17
Genomic Start Position7586654
Genomic End Position7586677
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.212
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -349.74
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
caucCCCUCC--CUCCUACCGUCU
;;;;;; ;;;; ;; ;;;
gaaaCCCTCCGGCTCCACCCGTCT
ctttGGGAGGCCGAGGTGGGCAGA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4769-3p
Chromosome17
Genomic Start Position7586790
Genomic End Position7586813
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.212
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -349.74
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
caucCCCUCC--CUCCUACCGUCU
;;;;;; ;;;; ;; ;;;
gaaaCCCTCCGACTCCGTCCGTCT
ctttGGGAGGCTGAGGCAGGCAGA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3613-5p
Chromosome17
Genomic Start Position7587025
Genomic End Position7587046
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.248
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -195.52
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
CUUGUUUUUUUUUUCAUGUUGU
;;; ;;;;;; ;;;; ; ; ;
CTTTTTTTTTCTTTCTTTCTTT
GAAAAAAAAAGAAAGAAAGAAA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-609
Chromosome17
Genomic Start Position7587383
Genomic End Position7587402
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.248
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -220.42
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
UCUCUACUCUCUUUguggga
$$$$$ $$$$$$$$
AGAGACGAGAGAAAtttgca
TCTCTGCTCTCTTTaaacgt
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4668-3p
Chromosome17
Genomic Start Position7589614
Genomic End Position7589636
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.256
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -193.88
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCUUUUUGUUUUUCCUaaaag
;;;;;;; ;;;;;; ;
ctCCTTTTTTTTTTTCTTaccca
gaGGAAAAAAAAAAAGAAtgggt
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4668-3p
Chromosome17
Genomic Start Position7589618
Genomic End Position7589640
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.268
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -193.88
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gacCUUUUUGUUUUUCCUaaaag
;;;;;; ;;;;;;;;
attCTTTTTTTTTTTCCTccggg
taaGAAAAAAAAAAAGGAggccc
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4290
Chromosome17
Genomic Start Position7589689
Genomic End Position7589708
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.240
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -313.26
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
CUCCCUUCUUU-CCUCCCgu
; ; ;;;;;;; ;;;;;;
CACACTTCTTTCCCTCCCtg
GTGTGAAGAAAGGGAGGGac
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1249
Chromosome17
Genomic Start Position7589692
Genomic End Position7589715
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.232
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -369.62
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCUUC-UUCCCCCCCU-UCCCGCa
;;;; ;;;;; ;;;; ;; ; ;
aCTTCTTTCCCTCCCTGTCTCACg
tGAAGAAAGGGAGGGACAGAGTGc
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1224-3p
Chromosome17
Genomic Start Position7589913
Genomic End Position7589934
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.260
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -359.68
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gacUCCUCUCUC-CUCCACCCC
; ;;;;;;; ;;;; ;;;;
attTTCTCTCTCTCTCCTCCCC
taaAAGAGAGAGAGAGGAGGGG
Match Typeindirect
Grade2
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-877-3p
Chromosome17
Genomic Start Position7589914
Genomic End Position7589935
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.252
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -313.26
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCCUCCUCCCUCU-UCUccu
;;;;;;;; ;;;; ;;;
tcCCCTCCTCTCTCTCTCTttt
agGGGAGGAGAGAGAGAGAaaa
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4769-3p
Chromosome17
Genomic Start Position7589915
Genomic End Position7589937
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.236
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -341.44
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
caUC-CCCUCCCUCCUACCGUCU
;; ; ;;; ;;;;; ;; ;;;
ttTCTCTCTCTCTCCTCCCCTCT
aaAGAGAGAGAGAGGAGGGGAGA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3184-3p
Chromosome17
Genomic Start Position7589915
Genomic End Position7589937
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.264
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -331.5
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCUCCCCGUCUCUCGCUCUgaaa
;;;;;; ;;;;; ;;;;
tCTCCCCTCCTCTCTCTCTcttt
aGAGGGGAGGAGAGAGAGAgaaa
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4723-3p
Chromosome17
Genomic Start Position7589916
Genomic End Position7589937
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.276
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -331.5
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aaaCCCCUCCUCGGUCUCUCcc
;;;;;;;;; ;;;;;;
tctCCCCTCCTCTCTCTCTCtt
agaGGGGAGGAGAGAGAGAGaa
Match Typeindirect
Grade2
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-483-3p
Chromosome17
Genomic Start Position7589917
Genomic End Position7589938
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.300
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -379.56
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
uUCUGCCCUCCUCUC-CUCACU
;;; ;;;;;;;;;; ;;; ;;
cTCTCCCCTCCTCTCTCTCTCT
gAGAGGGGAGGAGAGAGAGAGA
Match Typeindirect
Grade1
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3615
Chromosome17
Genomic Start Position7589917
Genomic End Position7589938
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.224
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -341.44
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
CUCGGCGCUCCUC-GGCUCUCU
;;; ; ;;;;;; ;;;;;;
CTCTCCCCTCCTCTCTCTCTCT
GAGAGGGGAGGAGAGAGAGAGA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1281
Chromosome17
Genomic Start Position7589918
Genomic End Position7589935
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.240
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -331.5
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
CCCUCUC-CUCCUCCGCU
; ;;;;; ;;;;;;; ;;
CTCTCTCTCTCCTCCCCT
GAGAGAGAGAGGAGGGGA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1249
Chromosome17
Genomic Start Position7589919
Genomic End Position7589942
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.200
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -359.68
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCUUCU-UCCCCCCCU-UCCCGCa
;; ;; ;;;;; ;;; ;; ; ;
gCTACTCTCCCCTCCTCTCTCTCt
cGATGAGAGGGGAGGAGAGAGAGa
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1224-3p
Chromosome17
Genomic Start Position7589923
Genomic End Position7589943
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.232
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -321.56
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCUCCUCUCUCCUCCACCCc
;; ;;;;; ;;;;; ; ;
ggCTACTCTCCCCTCCTCTCt
ccGATGAGAGGGGAGGAGAGa
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3162-3p
Chromosome17
Genomic Start Position7590591
Genomic End Position7590613
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.168
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -376.28
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCCCC--UCACCUCCCCAUCCCu
;;;; ; ;; ;;;; ;; ;
aCCCCGACCCCCACCCCGTCACc
tGGGGCTGGGGGTGGGGCAGTGg
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-877-3p
Chromosome17
Genomic Start Position7590963
Genomic End Position7590983
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.276
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -349.74
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCCUCCUCCCUCUUCUCcu
$$$$$$$$$$ $ $$$$
tgGGGAGGAGGGTGCAGAGtc
acCCCTCCTCCCACGTCTCag
Match Typedirect
Grade2
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4716-5p
Chromosome17
Genomic Start Position7591107
Genomic End Position7591129
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.248
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -323.2
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
uCUUCCC-CCUUCCUUUGUACcu
$$$$$$ $$$$$$$$ $ $
tGAAGGGTGGAAGGAAGAAAGct
aCTTCCCACCTTCCTTCTTTCga
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-877-3p
Chromosome17
Genomic Start Position7591819
Genomic End Position7591840
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.240
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -331.5
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCCUCCUC-CCUCUUCUCcu
;;;;;;;; ;; ;;; ;;
ggCCCTCCTCTCCGCTTGTCgc
ccGGGAGGAGAGGCGAACAGcg
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-877-3p
Chromosome17
Genomic Start Position7591827
Genomic End Position7591853
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.212
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -379.56
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCCUCCUCCC-----UCUUCU-CCU
; ;;;;;;;; ;;;;;; ;;;
gcCTCTCCTCCCGGGAGTCTTCTGCCT
cgGAGAGGAGGGCCCTCAGAAGACGGA
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-877-3p
Chromosome17
Genomic Start Position7591841
Genomic End Position7591861
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.256
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -285.08
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCCUCCUCCCUCUUCUccu
;;;;; ;;; ;;;;;;
gaCCCTCATCCGTCTTCTgag
ctGGGAGTAGGCAGAAGActc
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-483-3p
Chromosome17
Genomic Start Position7591856
Genomic End Position7591876
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.244
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -285.08
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
UUCUGCCCUCCUCUCCUcacu
$ $$ $$$$$$$$$ $$
ACGAAGGGAGGAGAAGAccct
TGCTTCCCTCCTCTTCTggga
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4290
Chromosome17
Genomic Start Position7591867
Genomic End Position7591886
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.240
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -331.5
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
CUCCCUUC-UUUCCUCCCgu
$$$$$$$$ $ $$$ $$$
GAGGGAAGCACAGGTGGGtt
CTCCCTTCGTGTCCACCCaa
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1224-3p
Chromosome17
Genomic Start Position7592026
Genomic End Position7592048
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.180
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -367.98
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCUCC-UCUC-UCCUCCACCCC
;;;; ; ; ;;;; ; ;;;;
agCTCCAGCCCATCCTTCTCCCC
tcGAGGTCGGGTAGGAAGAGGGG
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-3162-3p
Chromosome17
Genomic Start Position7592028
Genomic End Position7592049
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.196
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -358.04
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCCCCUC-ACCUCCCCAUCCcu
;;;;;; ;;; ;;; ;;
aCCCCTCTTCCTACCCGACCtc
tGGGGAGAAGGATGGGCTGGag
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1249
Chromosome17
Genomic Start Position7592039
Genomic End Position7592060
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.264
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -331.5
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCUUCUUCCCCCCCUUCCCgca
;;;;; ;;; ; ;;;;;;
cCTTCTCCCCACGCTTCCCcga
gGAAGAGGGGTGCGAAGGGgct
Match Typeindirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4769-3p
Chromosome17
Genomic Start Position7594282
Genomic End Position7594305
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.212
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -349.74
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
caucCCCUCC--CUCCUACCGUCU
$$$$$$ $$$$ $$ $$$
ctttGGGAGGCTGAGGTGGGCAGA
gaaaCCCTCCGACTCCACCCGTCT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-483-3p
Chromosome17
Genomic Start Position7594285
Genomic End Position7594306
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.216
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -349.74
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
uUCUGCCCUCCUC-UCCUCACu
$$$ $$$ $$$$ $$$$ $
tAGACGGGTGGAGTCGGAGGGt
aTCTGCCCACCTCAGCCTCCCa
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-1249
Chromosome17
Genomic Start Position7594612
Genomic End Position7594636
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.196
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -387.86
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
aCU-UCUUC-CCCCCCU-UCCCGCa
$$ $$ $$ $$$$ $$ $$$$ $
aGACAGGAGTGGGGAGACAGGGGGa
tCTGTCCTCACCCCTCTGTCCCCCt
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-877-3p
Chromosome17
Genomic Start Position7594624
Genomic End Position7594644
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.pyrimidine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.252
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -295.02
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gaCCCUCCUCCCUCUUCUCCU
$ $$$$$ $$$$$$$$ $
ggGTGAGGACAGAGAAGAGCA
ccCACTCCTGTCTCTTCTCGT
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4739
Chromosome17
Genomic Start Position7595691
Genomic End Position7595717
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.204
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -352.47
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
ucccgGGGAGG-CGAGG-AGGAGGgaa
$$$$$$ $$$$ $$$ $$
actttGGGAGGCTGAGGCAGGTGGatc
tgaaaCCCTCCGACTCCGTCCACCtag
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)
FeatureValue
microRNAhsa-miR-4459
Chromosome17
Genomic Start Position7595694
Genomic End Position7595716
Base TypeInformationBase TypeTriplex structures can be classified into two types: Hoogsteen Triplexes and Reverse-Hoogsteen Triplexes. Hoogsteen Triplexes rely on Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "pyrimidine" bases and run parallel to the purine-rich strand of the duplex. Reverse-Hoogsteen Triplexes rely on Reverse-Hoogsteen base pairings, and this pairing scheme dictates that the third strand be primarily "purine" bases and run anti-parallel to the purine-rich strand of the duplex. A base type of "pyrimidine" indicates that the interaction is a Hoogsteen Triplex, and a base type of "purine" indicates that the interaction is a Reverse-Hoogsteen Triplex.purine
Hit ScoreInformationHit ScorePotential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Score" is a metric of complementarity, measuring how well the triplets of a triplex line up.228
Hit EnergyInformationHit Energy Potential interactions between microRNAs and targets within their associated genome are evaluated using the Trident algorithm. Trident rates potential microRNA target sites using two methods. Here, "Hit Energy" is a metric of thermodynamic stability, measuring the minimum free energy of an interaction. -335.31
Hit structureInformationHit structure This is a schematic of the microRNA/double stranded DNA interaction. The presence of a connector between a base on the duplex and a base on the third strand indicates a viable triplet.
gAGGUGGA-GGAGGCGGAGGacc
$$$ $$$ $$$$ $$$$$
tAGGTGGACGGAGTCGGAGGgtt
aTCCACCTGCCTCAGCCTCCcaa
Match Typedirect
Grade3
GenomeHomo sapiens (GRCh37.p5)
Genomic context Browse Trident Data (1000 basepair padding)   Browse Trident Data (5000 basepair padding)

St. Jude Children's Research Hospital | St. Jude Research